Review



target selector pspgrna  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc target selector pspgrna
    Target Selector Pspgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 164 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+selector+pspgrna/pSPgRNA+(Plasmid+%2347108)/ppr0956631-235-16-19
    Average 96 stars, based on 164 article reviews
    target selector pspgrna - by Bioz Stars, 2026-11
    96/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Mapping the druggable targets displayed by human colonic enteroendocrine cells
    Article Snippet: .. The three plasmids comprising the CRISPR-HOT system for targeting the endogenous CHGA gene locus include the target selector pSPgRNA (Addgene #47108), with sgRNA (CAGCTGCAGGCACTACGGCGGGG) inserted using a previously described protocol 72, the frame selector pCas9-mCherry-Frame + 1 (Addgene plasmid #66940), and the universal donor pCRISPaint-mNeon (Addgene #174092) 9. ..

    Article Title: Mapping the druggable targets displayed by human colonic enteroendocrine cells
    Article Snippet: .. The three plasmids comprising the CRISPR-HOT system for targeting the endogenous CHGA gene locus include the target selector pSPgRNA (Addgene #47108), with sgRNA (CAGCTGCAGGCACTACGGCGGGG) inserted using a previously described protocol , the frame selector pCas9-mCherry-Frame +1 (Addgene plasmid #66940), and the universal donor pCRISPaint-mNeon (Addgene #174092) . ..

    Plasmid Preparation:

    Article Title: Mapping the druggable targets displayed by human colonic enteroendocrine cells
    Article Snippet: .. The three plasmids comprising the CRISPR-HOT system for targeting the endogenous CHGA gene locus include the target selector pSPgRNA (Addgene #47108), with sgRNA (CAGCTGCAGGCACTACGGCGGGG) inserted using a previously described protocol 72, the frame selector pCas9-mCherry-Frame + 1 (Addgene plasmid #66940), and the universal donor pCRISPaint-mNeon (Addgene #174092) 9. ..

    Article Title: Mapping the druggable targets displayed by human colonic enteroendocrine cells
    Article Snippet: .. The three plasmids comprising the CRISPR-HOT system for targeting the endogenous CHGA gene locus include the target selector pSPgRNA (Addgene #47108), with sgRNA (CAGCTGCAGGCACTACGGCGGGG) inserted using a previously described protocol , the frame selector pCas9-mCherry-Frame +1 (Addgene plasmid #66940), and the universal donor pCRISPaint-mNeon (Addgene #174092) . ..



    Similar Products

    target selector pspgrna  (Addgene inc)
    96
    Addgene inc target selector pspgrna
    Target Selector Pspgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/target+selector+pspgrna/pSPgRNA+(Plasmid+%2347108)/ppr0956631-235-16-19
    Average 96 stars, based on 1 article reviews
    target selector pspgrna - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier

    Image Search Results